First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops

Autores
Pozzi, Elizabeth Alicia; Luciani, Cecilia Elizabeth; Giovani Celli, Marcos Giovani; Conci, Vilma Cecilia; Perotto, María Cecilia
Año de publicación
2020
Idioma
inglés
Tipo de recurso
artículo
Estado
versión publicada
Descripción
Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.
info:eu-repo/semantics/publishedVersion
Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Materia
Cucurbitaceae
Virosis
Enfermedades de las plantas
Nivel de accesibilidad
acceso abierto
Condiciones de uso
Repositorio
Repositorio Digital Universitario (UNC)
Institución
Universidad Nacional de Córdoba
OAI Identificador
oai:rdu.unc.edu.ar:11086/548585

id RDUUNC_dcc84c52ba942f7b5407ec10327f0fb0
oai_identifier_str oai:rdu.unc.edu.ar:11086/548585
network_acronym_str RDUUNC
repository_id_str 2572
network_name_str Repositorio Digital Universitario (UNC)
spelling First report of Zucchini lethal chlorosis virus in Argentina infecting squash cropsPozzi, Elizabeth AliciaLuciani, Cecilia ElizabethGiovani Celli, Marcos GiovaniConci, Vilma CeciliaPerotto, María CeciliaCucurbitaceaeVirosisEnfermedades de las plantasFil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.info:eu-repo/semantics/publishedVersionFil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.2020info:eu-repo/semantics/publishedVersioninfo:eu-repo/semantics/articlehttp://purl.org/coar/resource_type/c_6501info:ar-repo/semantics/articuloapplication/pdfPozzi, E. A., Luciani, C. E., Giovani Celli, M. G., Conci, V. C. & Perotto, M. C. (2020) First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops. Plant Disease 104 (2): 602. https://doi.org/10.1094/PDIS-05-19-1064-PDNhttp://hdl.handle.net/11086/5485851943-7692https://doi.org/10.1094/PDIS-05-19-1064-PDNhttps://apsjournals.apsnet.org/journal/pdisenginfo:eu-repo/semantics/openAccessreponame:Repositorio Digital Universitario (UNC)instname:Universidad Nacional de Córdobainstacron:UNC2026-04-16T09:48:49Zoai:rdu.unc.edu.ar:11086/548585Institucionalhttps://rdu.unc.edu.ar/Universidad públicaNo correspondehttp://rdu.unc.edu.ar/oai/snrdoca.unc@gmail.comArgentinaNo correspondeNo correspondeNo correspondeopendoar:25722026-04-16 09:48:50.225Repositorio Digital Universitario (UNC) - Universidad Nacional de Córdobafalse
dc.title.none.fl_str_mv First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
title First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
spellingShingle First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
Pozzi, Elizabeth Alicia
Cucurbitaceae
Virosis
Enfermedades de las plantas
title_short First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
title_full First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
title_fullStr First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
title_full_unstemmed First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
title_sort First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
dc.creator.none.fl_str_mv Pozzi, Elizabeth Alicia
Luciani, Cecilia Elizabeth
Giovani Celli, Marcos Giovani
Conci, Vilma Cecilia
Perotto, María Cecilia
author Pozzi, Elizabeth Alicia
author_facet Pozzi, Elizabeth Alicia
Luciani, Cecilia Elizabeth
Giovani Celli, Marcos Giovani
Conci, Vilma Cecilia
Perotto, María Cecilia
author_role author
author2 Luciani, Cecilia Elizabeth
Giovani Celli, Marcos Giovani
Conci, Vilma Cecilia
Perotto, María Cecilia
author2_role author
author
author
author
dc.subject.none.fl_str_mv Cucurbitaceae
Virosis
Enfermedades de las plantas
topic Cucurbitaceae
Virosis
Enfermedades de las plantas
dc.description.none.fl_txt_mv Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.
info:eu-repo/semantics/publishedVersion
Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
description Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
publishDate 2020
dc.date.none.fl_str_mv 2020
dc.type.none.fl_str_mv info:eu-repo/semantics/publishedVersion
info:eu-repo/semantics/article
http://purl.org/coar/resource_type/c_6501
info:ar-repo/semantics/articulo
status_str publishedVersion
format article
dc.identifier.none.fl_str_mv Pozzi, E. A., Luciani, C. E., Giovani Celli, M. G., Conci, V. C. & Perotto, M. C. (2020) First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops. Plant Disease 104 (2): 602. https://doi.org/10.1094/PDIS-05-19-1064-PDN
http://hdl.handle.net/11086/548585
1943-7692
https://doi.org/10.1094/PDIS-05-19-1064-PDN
https://apsjournals.apsnet.org/journal/pdis
identifier_str_mv Pozzi, E. A., Luciani, C. E., Giovani Celli, M. G., Conci, V. C. & Perotto, M. C. (2020) First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops. Plant Disease 104 (2): 602. https://doi.org/10.1094/PDIS-05-19-1064-PDN
1943-7692
url http://hdl.handle.net/11086/548585
https://doi.org/10.1094/PDIS-05-19-1064-PDN
https://apsjournals.apsnet.org/journal/pdis
dc.language.none.fl_str_mv eng
language eng
dc.rights.none.fl_str_mv info:eu-repo/semantics/openAccess
eu_rights_str_mv openAccess
dc.format.none.fl_str_mv application/pdf
dc.source.none.fl_str_mv reponame:Repositorio Digital Universitario (UNC)
instname:Universidad Nacional de Córdoba
instacron:UNC
reponame_str Repositorio Digital Universitario (UNC)
collection Repositorio Digital Universitario (UNC)
instname_str Universidad Nacional de Córdoba
instacron_str UNC
institution UNC
repository.name.fl_str_mv Repositorio Digital Universitario (UNC) - Universidad Nacional de Córdoba
repository.mail.fl_str_mv oca.unc@gmail.com
_version_ 1862635121858838528
score 12.692636