First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
- Autores
- Pozzi, Elizabeth Alicia; Luciani, Cecilia Elizabeth; Giovani Celli, Marcos Giovani; Conci, Vilma Cecilia; Perotto, María Cecilia
- Año de publicación
- 2020
- Idioma
- inglés
- Tipo de recurso
- artículo
- Estado
- versión publicada
- Descripción
- Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.
info:eu-repo/semantics/publishedVersion
Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.
Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.
Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina. - Materia
-
Cucurbitaceae
Virosis
Enfermedades de las plantas - Nivel de accesibilidad
- acceso abierto
- Condiciones de uso
- Repositorio
.jpg)
- Institución
- Universidad Nacional de Córdoba
- OAI Identificador
- oai:rdu.unc.edu.ar:11086/548585
Ver los metadatos del registro completo
| id |
RDUUNC_dcc84c52ba942f7b5407ec10327f0fb0 |
|---|---|
| oai_identifier_str |
oai:rdu.unc.edu.ar:11086/548585 |
| network_acronym_str |
RDUUNC |
| repository_id_str |
2572 |
| network_name_str |
Repositorio Digital Universitario (UNC) |
| spelling |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash cropsPozzi, Elizabeth AliciaLuciani, Cecilia ElizabethGiovani Celli, Marcos GiovaniConci, Vilma CeciliaPerotto, María CeciliaCucurbitaceaeVirosisEnfermedades de las plantasFil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.info:eu-repo/semantics/publishedVersionFil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina.Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina.2020info:eu-repo/semantics/publishedVersioninfo:eu-repo/semantics/articlehttp://purl.org/coar/resource_type/c_6501info:ar-repo/semantics/articuloapplication/pdfPozzi, E. A., Luciani, C. E., Giovani Celli, M. G., Conci, V. C. & Perotto, M. C. (2020) First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops. Plant Disease 104 (2): 602. https://doi.org/10.1094/PDIS-05-19-1064-PDNhttp://hdl.handle.net/11086/5485851943-7692https://doi.org/10.1094/PDIS-05-19-1064-PDNhttps://apsjournals.apsnet.org/journal/pdisenginfo:eu-repo/semantics/openAccessreponame:Repositorio Digital Universitario (UNC)instname:Universidad Nacional de Córdobainstacron:UNC2026-06-04T09:42:40Zoai:rdu.unc.edu.ar:11086/548585Institucionalhttps://rdu.unc.edu.ar/Universidad públicaNo correspondehttp://rdu.unc.edu.ar/oai/snrdoca.unc@gmail.comArgentinaNo correspondeNo correspondeNo correspondeopendoar:25722026-06-04 09:42:41.161Repositorio Digital Universitario (UNC) - Universidad Nacional de Córdobafalse |
| dc.title.none.fl_str_mv |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| spellingShingle |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops Pozzi, Elizabeth Alicia Cucurbitaceae Virosis Enfermedades de las plantas |
| title_short |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title_full |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title_fullStr |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title_full_unstemmed |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title_sort |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| dc.creator.none.fl_str_mv |
Pozzi, Elizabeth Alicia Luciani, Cecilia Elizabeth Giovani Celli, Marcos Giovani Conci, Vilma Cecilia Perotto, María Cecilia |
| author |
Pozzi, Elizabeth Alicia |
| author_facet |
Pozzi, Elizabeth Alicia Luciani, Cecilia Elizabeth Giovani Celli, Marcos Giovani Conci, Vilma Cecilia Perotto, María Cecilia |
| author_role |
author |
| author2 |
Luciani, Cecilia Elizabeth Giovani Celli, Marcos Giovani Conci, Vilma Cecilia Perotto, María Cecilia |
| author2_role |
author author author author |
| dc.subject.none.fl_str_mv |
Cucurbitaceae Virosis Enfermedades de las plantas |
| topic |
Cucurbitaceae Virosis Enfermedades de las plantas |
| dc.description.none.fl_txt_mv |
Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina. Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina. Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina. Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina. info:eu-repo/semantics/publishedVersion Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina. Fil: Giovani Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina. Fil: Perotto, María Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. Fil: Perotto, María Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Centro de Investigaciones Agropecuarias (CIAP). Instituto de Patología Vegetal (IPAVE); Argentina. |
| description |
Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Centro Científico Tecnológico (CCT Córdoba); Argentina. |
| publishDate |
2020 |
| dc.date.none.fl_str_mv |
2020 |
| dc.type.none.fl_str_mv |
info:eu-repo/semantics/publishedVersion info:eu-repo/semantics/article http://purl.org/coar/resource_type/c_6501 info:ar-repo/semantics/articulo |
| status_str |
publishedVersion |
| format |
article |
| dc.identifier.none.fl_str_mv |
Pozzi, E. A., Luciani, C. E., Giovani Celli, M. G., Conci, V. C. & Perotto, M. C. (2020) First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops. Plant Disease 104 (2): 602. https://doi.org/10.1094/PDIS-05-19-1064-PDN http://hdl.handle.net/11086/548585 1943-7692 https://doi.org/10.1094/PDIS-05-19-1064-PDN https://apsjournals.apsnet.org/journal/pdis |
| identifier_str_mv |
Pozzi, E. A., Luciani, C. E., Giovani Celli, M. G., Conci, V. C. & Perotto, M. C. (2020) First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops. Plant Disease 104 (2): 602. https://doi.org/10.1094/PDIS-05-19-1064-PDN 1943-7692 |
| url |
http://hdl.handle.net/11086/548585 https://doi.org/10.1094/PDIS-05-19-1064-PDN https://apsjournals.apsnet.org/journal/pdis |
| dc.language.none.fl_str_mv |
eng |
| language |
eng |
| dc.rights.none.fl_str_mv |
info:eu-repo/semantics/openAccess |
| eu_rights_str_mv |
openAccess |
| dc.format.none.fl_str_mv |
application/pdf |
| dc.source.none.fl_str_mv |
reponame:Repositorio Digital Universitario (UNC) instname:Universidad Nacional de Córdoba instacron:UNC |
| reponame_str |
Repositorio Digital Universitario (UNC) |
| collection |
Repositorio Digital Universitario (UNC) |
| instname_str |
Universidad Nacional de Córdoba |
| instacron_str |
UNC |
| institution |
UNC |
| repository.name.fl_str_mv |
Repositorio Digital Universitario (UNC) - Universidad Nacional de Córdoba |
| repository.mail.fl_str_mv |
oca.unc@gmail.com |
| _version_ |
1867091282347687936 |
| score |
12.832306 |