First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops
- Autores
- Pozzi, Elizabeth Alicia; Luciani, Cecilia Elizabeth; Giovani Celli, Marcos Giovani; Conci, Vilma Cecilia; Perotto, Maria Cecilia
- Año de publicación
- 2020
- Idioma
- inglés
- Tipo de recurso
- artículo
- Estado
- versión publicada
- Descripción
- Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. ?cayote?, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.
Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina. Instituto Nacional de Tecnologia Agropecuaria. Centro Regional Cordoba. Estacion Experimental Agropecuaria Marcos Juarez. Agencia de Extension Rural Bell Ville.; Argentina
Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina
Fil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina
Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina
Fil: Perotto, Maria Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina - Materia
-
VIRUS
CUCURBITACEAS - Nivel de accesibilidad
- acceso abierto
- Condiciones de uso
- https://creativecommons.org/licenses/by-nc-sa/2.5/ar/
- Repositorio
.jpg)
- Institución
- Consejo Nacional de Investigaciones Científicas y Técnicas
- OAI Identificador
- oai:ri.conicet.gov.ar:11336/126519
Ver los metadatos del registro completo
| id |
CONICETDig_177341e873d1f18c00de28215e83c855 |
|---|---|
| oai_identifier_str |
oai:ri.conicet.gov.ar:11336/126519 |
| network_acronym_str |
CONICETDig |
| repository_id_str |
3498 |
| network_name_str |
CONICET Digital (CONICET) |
| spelling |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash cropsPozzi, Elizabeth AliciaLuciani, Cecilia ElizabethGiovani Celli, Marcos GiovaniConci, Vilma CeciliaPerotto, Maria CeciliaVIRUSCUCURBITACEAShttps://purl.org/becyt/ford/4.5https://purl.org/becyt/ford/4Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. ?cayote?, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina. Instituto Nacional de Tecnologia Agropecuaria. Centro Regional Cordoba. Estacion Experimental Agropecuaria Marcos Juarez. Agencia de Extension Rural Bell Ville.; ArgentinaFil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Conci, Vilma Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Perotto, Maria Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaAmerican Phytopathological Society2020-02info:eu-repo/semantics/articleinfo:eu-repo/semantics/publishedVersionhttp://purl.org/coar/resource_type/c_6501info:ar-repo/semantics/articuloapplication/pdfapplication/pdfhttp://hdl.handle.net/11336/126519Pozzi, Elizabeth Alicia; Luciani, Cecilia Elizabeth; Giovani Celli, Marcos Giovani; Conci, Vilma Cecilia; Perotto, Maria Cecilia; First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops; American Phytopathological Society; Plant Disease; 104; 2; 2-2020; 602-6020191-29171943-7692CONICET DigitalCONICETenginfo:eu-repo/semantics/altIdentifier/url/https://apsjournals.apsnet.org/doi/10.1094/PDIS-05-19-1064-PDNinfo:eu-repo/semantics/altIdentifier/doi/10.1094/PDIS-05-19-1064-PDNinfo:eu-repo/semantics/openAccesshttps://creativecommons.org/licenses/by-nc-sa/2.5/ar/reponame:CONICET Digital (CONICET)instname:Consejo Nacional de Investigaciones Científicas y Técnicas2026-04-15T10:31:33Zoai:ri.conicet.gov.ar:11336/126519instacron:CONICETInstitucionalhttp://ri.conicet.gov.ar/Organismo científico-tecnológicoNo correspondehttp://ri.conicet.gov.ar/oai/requestdasensio@conicet.gov.ar; lcarlino@conicet.gov.arArgentinaNo correspondeNo correspondeNo correspondeopendoar:34982026-04-15 10:31:34.004CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicasfalse |
| dc.title.none.fl_str_mv |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| spellingShingle |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops Pozzi, Elizabeth Alicia VIRUS CUCURBITACEAS |
| title_short |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title_full |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title_fullStr |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title_full_unstemmed |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| title_sort |
First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops |
| dc.creator.none.fl_str_mv |
Pozzi, Elizabeth Alicia Luciani, Cecilia Elizabeth Giovani Celli, Marcos Giovani Conci, Vilma Cecilia Perotto, Maria Cecilia |
| author |
Pozzi, Elizabeth Alicia |
| author_facet |
Pozzi, Elizabeth Alicia Luciani, Cecilia Elizabeth Giovani Celli, Marcos Giovani Conci, Vilma Cecilia Perotto, Maria Cecilia |
| author_role |
author |
| author2 |
Luciani, Cecilia Elizabeth Giovani Celli, Marcos Giovani Conci, Vilma Cecilia Perotto, Maria Cecilia |
| author2_role |
author author author author |
| dc.subject.none.fl_str_mv |
VIRUS CUCURBITACEAS |
| topic |
VIRUS CUCURBITACEAS |
| purl_subject.fl_str_mv |
https://purl.org/becyt/ford/4.5 https://purl.org/becyt/ford/4 |
| dc.description.none.fl_txt_mv |
Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. ?cayote?, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina. Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina. Instituto Nacional de Tecnologia Agropecuaria. Centro Regional Cordoba. Estacion Experimental Agropecuaria Marcos Juarez. Agencia de Extension Rural Bell Ville.; Argentina Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina Fil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina Fil: Perotto, Maria Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina |
| description |
Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. ?cayote?, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina. |
| publishDate |
2020 |
| dc.date.none.fl_str_mv |
2020-02 |
| dc.type.none.fl_str_mv |
info:eu-repo/semantics/article info:eu-repo/semantics/publishedVersion http://purl.org/coar/resource_type/c_6501 info:ar-repo/semantics/articulo |
| format |
article |
| status_str |
publishedVersion |
| dc.identifier.none.fl_str_mv |
http://hdl.handle.net/11336/126519 Pozzi, Elizabeth Alicia; Luciani, Cecilia Elizabeth; Giovani Celli, Marcos Giovani; Conci, Vilma Cecilia; Perotto, Maria Cecilia; First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops; American Phytopathological Society; Plant Disease; 104; 2; 2-2020; 602-602 0191-2917 1943-7692 CONICET Digital CONICET |
| url |
http://hdl.handle.net/11336/126519 |
| identifier_str_mv |
Pozzi, Elizabeth Alicia; Luciani, Cecilia Elizabeth; Giovani Celli, Marcos Giovani; Conci, Vilma Cecilia; Perotto, Maria Cecilia; First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops; American Phytopathological Society; Plant Disease; 104; 2; 2-2020; 602-602 0191-2917 1943-7692 CONICET Digital CONICET |
| dc.language.none.fl_str_mv |
eng |
| language |
eng |
| dc.relation.none.fl_str_mv |
info:eu-repo/semantics/altIdentifier/url/https://apsjournals.apsnet.org/doi/10.1094/PDIS-05-19-1064-PDN info:eu-repo/semantics/altIdentifier/doi/10.1094/PDIS-05-19-1064-PDN |
| dc.rights.none.fl_str_mv |
info:eu-repo/semantics/openAccess https://creativecommons.org/licenses/by-nc-sa/2.5/ar/ |
| eu_rights_str_mv |
openAccess |
| rights_invalid_str_mv |
https://creativecommons.org/licenses/by-nc-sa/2.5/ar/ |
| dc.format.none.fl_str_mv |
application/pdf application/pdf |
| dc.publisher.none.fl_str_mv |
American Phytopathological Society |
| publisher.none.fl_str_mv |
American Phytopathological Society |
| dc.source.none.fl_str_mv |
reponame:CONICET Digital (CONICET) instname:Consejo Nacional de Investigaciones Científicas y Técnicas |
| reponame_str |
CONICET Digital (CONICET) |
| collection |
CONICET Digital (CONICET) |
| instname_str |
Consejo Nacional de Investigaciones Científicas y Técnicas |
| repository.name.fl_str_mv |
CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicas |
| repository.mail.fl_str_mv |
dasensio@conicet.gov.ar; lcarlino@conicet.gov.ar |
| _version_ |
1862633202109120512 |
| score |
13.203462 |