First report of Fusarium poae on tomato in Argentina
- Autores
- Stenglein, Sebastian Alberto; Barreto, D.; Nicholson, P.; Chandler, E.; Brambilla, V.; Piris, E. M.; Saliva, V.; Mitidieri, Mariel Silvina; Salerno, Graciela Lidia
- Año de publicación
- 2009
- Idioma
- inglés
- Tipo de recurso
- artículo
- Estado
- versión publicada
- Descripción
- During the spring of 2003, blighted flowers were observed on numerous plants (ca. 20%) of a tomato (Solanum lycopersicum formerly Lycopersicon esculentum) crop in two glasshouses (approx. 300–400 m2 each) in San Pedro, Buenos Aires, Argentina. Pedicels of flowers turned chlorotic and later became necrotic. Subsequently, the calyx and the petals turned brown, and the flowers shrivelled and generally abscised. Small pieces of diseased tissue were surface sterilized with 0·5% NaOCl, plated on 2% potato dextrose agar (PDA) at pH 6, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 72–96 h. Microconidia were abundant, globose to piriform, 0–1 septate, 4–10 × 4·5–7 µm, and formed on unbranched and branched monophialides. Cultures produced a fruity aroma similar to amyl acetate. Spores from 14‐day‐old colonies that developed on PDA were removed with 4 mL of sterile water. The pathogenicity of the fungus was tested by spraying five healthy inflorescences of tomato with a 5‐mL suspension (2 × 105 conidia mL−1 of sterile distilled water). Another five healthy inflorescences were sprayed with sterile distilled water. The plants were placed in a growth chamber with a 12‐h photoperiod at 22 ± 2°C and covered with polyethylene bags that were removed after 3 days when plants were moved to a glasshouse. While control flowers were healthy, all inoculated flowers showed symptoms similar to those observed previously. A fungus was consistently isolated from diseased tissue in the inoculated plants and identified as Fusarium poae on the basis of fungal morphology (Nelson et al., 1983) and production of an amplicon of the appropriate size with primers 5′‐CAAGCAAACAGGCTCTTCACC‐3′‐forward and 5′‐TGTTCCACCTCAGTGACAGGTT‐3′‐reverse (Parry & Nicholson, 1996). This is the first report of this fungus on tomato in Argentina. Fusarium poae is one of the main causal agents of fusarium head blight of wheat. The increasing occurrence of this fungus in Argentinean cereals and the finding of F. poae infecting tomato could be of importance due to the close proximity of the two crops in some areas, as this may represent an alternative host. In addition, because of the potential for F. poae to produce trichothecene mycotoxins such as nivalenol, this is of significance as it may pose toxicological risks to consumers if tomato fruit become infected.
Fil: Stenglein, Sebastian Alberto. Universidad Nacional del Centro de la Provincia de Bueno Aires. Facultad de Agronomía. Laboratorio de Biología Funcional y Biotecnología; Argentina
Fil: Barreto, D.. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigación en Ciencias Veterinarias y Agronómicas. Instituto de Microbiología y Zoología Agrícola; Argentina
Fil: Nicholson, P.. Norwich Research Park; Reino Unido
Fil: Chandler, E.. Norwich Research Park; Reino Unido
Fil: Brambilla, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Piris, E. M.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Saliva, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Mitidieri, Mariel Silvina. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Salerno, Graciela Lidia. Consejo Nacional de Investigaciones Cientificas y Tecnicas. Oficina de Coordinacion Administrativa Pque. Centenario. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp | Universidad de Buenos Aires. Facultad de Agronomia. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp. ; Argentina; Argentina - Materia
-
FUSARIUM POAE
TOMATO - Nivel de accesibilidad
- acceso abierto
- Condiciones de uso
- https://creativecommons.org/licenses/by-nc-sa/2.5/ar/
- Repositorio
- Institución
- Consejo Nacional de Investigaciones Científicas y Técnicas
- OAI Identificador
- oai:ri.conicet.gov.ar:11336/112349
Ver los metadatos del registro completo
id |
CONICETDig_af049971708aa5ba60730e5e629a7a79 |
---|---|
oai_identifier_str |
oai:ri.conicet.gov.ar:11336/112349 |
network_acronym_str |
CONICETDig |
repository_id_str |
3498 |
network_name_str |
CONICET Digital (CONICET) |
spelling |
First report of Fusarium poae on tomato in ArgentinaStenglein, Sebastian AlbertoBarreto, D.Nicholson, P.Chandler, E.Brambilla, V.Piris, E. M.Saliva, V.Mitidieri, Mariel SilvinaSalerno, Graciela LidiaFUSARIUM POAETOMATOhttps://purl.org/becyt/ford/4.1https://purl.org/becyt/ford/4During the spring of 2003, blighted flowers were observed on numerous plants (ca. 20%) of a tomato (Solanum lycopersicum formerly Lycopersicon esculentum) crop in two glasshouses (approx. 300–400 m2 each) in San Pedro, Buenos Aires, Argentina. Pedicels of flowers turned chlorotic and later became necrotic. Subsequently, the calyx and the petals turned brown, and the flowers shrivelled and generally abscised. Small pieces of diseased tissue were surface sterilized with 0·5% NaOCl, plated on 2% potato dextrose agar (PDA) at pH 6, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 72–96 h. Microconidia were abundant, globose to piriform, 0–1 septate, 4–10 × 4·5–7 µm, and formed on unbranched and branched monophialides. Cultures produced a fruity aroma similar to amyl acetate. Spores from 14‐day‐old colonies that developed on PDA were removed with 4 mL of sterile water. The pathogenicity of the fungus was tested by spraying five healthy inflorescences of tomato with a 5‐mL suspension (2 × 105 conidia mL−1 of sterile distilled water). Another five healthy inflorescences were sprayed with sterile distilled water. The plants were placed in a growth chamber with a 12‐h photoperiod at 22 ± 2°C and covered with polyethylene bags that were removed after 3 days when plants were moved to a glasshouse. While control flowers were healthy, all inoculated flowers showed symptoms similar to those observed previously. A fungus was consistently isolated from diseased tissue in the inoculated plants and identified as Fusarium poae on the basis of fungal morphology (Nelson et al., 1983) and production of an amplicon of the appropriate size with primers 5′‐CAAGCAAACAGGCTCTTCACC‐3′‐forward and 5′‐TGTTCCACCTCAGTGACAGGTT‐3′‐reverse (Parry & Nicholson, 1996). This is the first report of this fungus on tomato in Argentina. Fusarium poae is one of the main causal agents of fusarium head blight of wheat. The increasing occurrence of this fungus in Argentinean cereals and the finding of F. poae infecting tomato could be of importance due to the close proximity of the two crops in some areas, as this may represent an alternative host. In addition, because of the potential for F. poae to produce trichothecene mycotoxins such as nivalenol, this is of significance as it may pose toxicological risks to consumers if tomato fruit become infected.Fil: Stenglein, Sebastian Alberto. Universidad Nacional del Centro de la Provincia de Bueno Aires. Facultad de Agronomía. Laboratorio de Biología Funcional y Biotecnología; ArgentinaFil: Barreto, D.. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigación en Ciencias Veterinarias y Agronómicas. Instituto de Microbiología y Zoología Agrícola; ArgentinaFil: Nicholson, P.. Norwich Research Park; Reino UnidoFil: Chandler, E.. Norwich Research Park; Reino UnidoFil: Brambilla, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; ArgentinaFil: Piris, E. M.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; ArgentinaFil: Saliva, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; ArgentinaFil: Mitidieri, Mariel Silvina. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; ArgentinaFil: Salerno, Graciela Lidia. Consejo Nacional de Investigaciones Cientificas y Tecnicas. Oficina de Coordinacion Administrativa Pque. Centenario. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp | Universidad de Buenos Aires. Facultad de Agronomia. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp. ; Argentina; ArgentinaWiley Blackwell Publishing, Inc2009-12info:eu-repo/semantics/articleinfo:eu-repo/semantics/publishedVersionhttp://purl.org/coar/resource_type/c_6501info:ar-repo/semantics/articuloapplication/pdfapplication/pdfapplication/pdfhttp://hdl.handle.net/11336/112349Stenglein, Sebastian Alberto; Barreto, D.; Nicholson, P.; Chandler, E.; Brambilla, V.; et al.; First report of Fusarium poae on tomato in Argentina; Wiley Blackwell Publishing, Inc; Plant Pathology; 58; 2; 12-2009; 401-4010032-0862CONICET DigitalCONICETenginfo:eu-repo/semantics/altIdentifier/doi/10.1111/j.1365-3059.2008.01973.xinfo:eu-repo/semantics/altIdentifier/url/https://bsppjournals.onlinelibrary.wiley.com/doi/full/10.1111/j.1365-3059.2008.01973.xinfo:eu-repo/semantics/openAccesshttps://creativecommons.org/licenses/by-nc-sa/2.5/ar/reponame:CONICET Digital (CONICET)instname:Consejo Nacional de Investigaciones Científicas y Técnicas2025-09-29T10:30:00Zoai:ri.conicet.gov.ar:11336/112349instacron:CONICETInstitucionalhttp://ri.conicet.gov.ar/Organismo científico-tecnológicoNo correspondehttp://ri.conicet.gov.ar/oai/requestdasensio@conicet.gov.ar; lcarlino@conicet.gov.arArgentinaNo correspondeNo correspondeNo correspondeopendoar:34982025-09-29 10:30:00.396CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicasfalse |
dc.title.none.fl_str_mv |
First report of Fusarium poae on tomato in Argentina |
title |
First report of Fusarium poae on tomato in Argentina |
spellingShingle |
First report of Fusarium poae on tomato in Argentina Stenglein, Sebastian Alberto FUSARIUM POAE TOMATO |
title_short |
First report of Fusarium poae on tomato in Argentina |
title_full |
First report of Fusarium poae on tomato in Argentina |
title_fullStr |
First report of Fusarium poae on tomato in Argentina |
title_full_unstemmed |
First report of Fusarium poae on tomato in Argentina |
title_sort |
First report of Fusarium poae on tomato in Argentina |
dc.creator.none.fl_str_mv |
Stenglein, Sebastian Alberto Barreto, D. Nicholson, P. Chandler, E. Brambilla, V. Piris, E. M. Saliva, V. Mitidieri, Mariel Silvina Salerno, Graciela Lidia |
author |
Stenglein, Sebastian Alberto |
author_facet |
Stenglein, Sebastian Alberto Barreto, D. Nicholson, P. Chandler, E. Brambilla, V. Piris, E. M. Saliva, V. Mitidieri, Mariel Silvina Salerno, Graciela Lidia |
author_role |
author |
author2 |
Barreto, D. Nicholson, P. Chandler, E. Brambilla, V. Piris, E. M. Saliva, V. Mitidieri, Mariel Silvina Salerno, Graciela Lidia |
author2_role |
author author author author author author author author |
dc.subject.none.fl_str_mv |
FUSARIUM POAE TOMATO |
topic |
FUSARIUM POAE TOMATO |
purl_subject.fl_str_mv |
https://purl.org/becyt/ford/4.1 https://purl.org/becyt/ford/4 |
dc.description.none.fl_txt_mv |
During the spring of 2003, blighted flowers were observed on numerous plants (ca. 20%) of a tomato (Solanum lycopersicum formerly Lycopersicon esculentum) crop in two glasshouses (approx. 300–400 m2 each) in San Pedro, Buenos Aires, Argentina. Pedicels of flowers turned chlorotic and later became necrotic. Subsequently, the calyx and the petals turned brown, and the flowers shrivelled and generally abscised. Small pieces of diseased tissue were surface sterilized with 0·5% NaOCl, plated on 2% potato dextrose agar (PDA) at pH 6, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 72–96 h. Microconidia were abundant, globose to piriform, 0–1 septate, 4–10 × 4·5–7 µm, and formed on unbranched and branched monophialides. Cultures produced a fruity aroma similar to amyl acetate. Spores from 14‐day‐old colonies that developed on PDA were removed with 4 mL of sterile water. The pathogenicity of the fungus was tested by spraying five healthy inflorescences of tomato with a 5‐mL suspension (2 × 105 conidia mL−1 of sterile distilled water). Another five healthy inflorescences were sprayed with sterile distilled water. The plants were placed in a growth chamber with a 12‐h photoperiod at 22 ± 2°C and covered with polyethylene bags that were removed after 3 days when plants were moved to a glasshouse. While control flowers were healthy, all inoculated flowers showed symptoms similar to those observed previously. A fungus was consistently isolated from diseased tissue in the inoculated plants and identified as Fusarium poae on the basis of fungal morphology (Nelson et al., 1983) and production of an amplicon of the appropriate size with primers 5′‐CAAGCAAACAGGCTCTTCACC‐3′‐forward and 5′‐TGTTCCACCTCAGTGACAGGTT‐3′‐reverse (Parry & Nicholson, 1996). This is the first report of this fungus on tomato in Argentina. Fusarium poae is one of the main causal agents of fusarium head blight of wheat. The increasing occurrence of this fungus in Argentinean cereals and the finding of F. poae infecting tomato could be of importance due to the close proximity of the two crops in some areas, as this may represent an alternative host. In addition, because of the potential for F. poae to produce trichothecene mycotoxins such as nivalenol, this is of significance as it may pose toxicological risks to consumers if tomato fruit become infected. Fil: Stenglein, Sebastian Alberto. Universidad Nacional del Centro de la Provincia de Bueno Aires. Facultad de Agronomía. Laboratorio de Biología Funcional y Biotecnología; Argentina Fil: Barreto, D.. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigación en Ciencias Veterinarias y Agronómicas. Instituto de Microbiología y Zoología Agrícola; Argentina Fil: Nicholson, P.. Norwich Research Park; Reino Unido Fil: Chandler, E.. Norwich Research Park; Reino Unido Fil: Brambilla, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina Fil: Piris, E. M.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina Fil: Saliva, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina Fil: Mitidieri, Mariel Silvina. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina Fil: Salerno, Graciela Lidia. Consejo Nacional de Investigaciones Cientificas y Tecnicas. Oficina de Coordinacion Administrativa Pque. Centenario. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp | Universidad de Buenos Aires. Facultad de Agronomia. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp. ; Argentina; Argentina |
description |
During the spring of 2003, blighted flowers were observed on numerous plants (ca. 20%) of a tomato (Solanum lycopersicum formerly Lycopersicon esculentum) crop in two glasshouses (approx. 300–400 m2 each) in San Pedro, Buenos Aires, Argentina. Pedicels of flowers turned chlorotic and later became necrotic. Subsequently, the calyx and the petals turned brown, and the flowers shrivelled and generally abscised. Small pieces of diseased tissue were surface sterilized with 0·5% NaOCl, plated on 2% potato dextrose agar (PDA) at pH 6, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 72–96 h. Microconidia were abundant, globose to piriform, 0–1 septate, 4–10 × 4·5–7 µm, and formed on unbranched and branched monophialides. Cultures produced a fruity aroma similar to amyl acetate. Spores from 14‐day‐old colonies that developed on PDA were removed with 4 mL of sterile water. The pathogenicity of the fungus was tested by spraying five healthy inflorescences of tomato with a 5‐mL suspension (2 × 105 conidia mL−1 of sterile distilled water). Another five healthy inflorescences were sprayed with sterile distilled water. The plants were placed in a growth chamber with a 12‐h photoperiod at 22 ± 2°C and covered with polyethylene bags that were removed after 3 days when plants were moved to a glasshouse. While control flowers were healthy, all inoculated flowers showed symptoms similar to those observed previously. A fungus was consistently isolated from diseased tissue in the inoculated plants and identified as Fusarium poae on the basis of fungal morphology (Nelson et al., 1983) and production of an amplicon of the appropriate size with primers 5′‐CAAGCAAACAGGCTCTTCACC‐3′‐forward and 5′‐TGTTCCACCTCAGTGACAGGTT‐3′‐reverse (Parry & Nicholson, 1996). This is the first report of this fungus on tomato in Argentina. Fusarium poae is one of the main causal agents of fusarium head blight of wheat. The increasing occurrence of this fungus in Argentinean cereals and the finding of F. poae infecting tomato could be of importance due to the close proximity of the two crops in some areas, as this may represent an alternative host. In addition, because of the potential for F. poae to produce trichothecene mycotoxins such as nivalenol, this is of significance as it may pose toxicological risks to consumers if tomato fruit become infected. |
publishDate |
2009 |
dc.date.none.fl_str_mv |
2009-12 |
dc.type.none.fl_str_mv |
info:eu-repo/semantics/article info:eu-repo/semantics/publishedVersion http://purl.org/coar/resource_type/c_6501 info:ar-repo/semantics/articulo |
format |
article |
status_str |
publishedVersion |
dc.identifier.none.fl_str_mv |
http://hdl.handle.net/11336/112349 Stenglein, Sebastian Alberto; Barreto, D.; Nicholson, P.; Chandler, E.; Brambilla, V.; et al.; First report of Fusarium poae on tomato in Argentina; Wiley Blackwell Publishing, Inc; Plant Pathology; 58; 2; 12-2009; 401-401 0032-0862 CONICET Digital CONICET |
url |
http://hdl.handle.net/11336/112349 |
identifier_str_mv |
Stenglein, Sebastian Alberto; Barreto, D.; Nicholson, P.; Chandler, E.; Brambilla, V.; et al.; First report of Fusarium poae on tomato in Argentina; Wiley Blackwell Publishing, Inc; Plant Pathology; 58; 2; 12-2009; 401-401 0032-0862 CONICET Digital CONICET |
dc.language.none.fl_str_mv |
eng |
language |
eng |
dc.relation.none.fl_str_mv |
info:eu-repo/semantics/altIdentifier/doi/10.1111/j.1365-3059.2008.01973.x info:eu-repo/semantics/altIdentifier/url/https://bsppjournals.onlinelibrary.wiley.com/doi/full/10.1111/j.1365-3059.2008.01973.x |
dc.rights.none.fl_str_mv |
info:eu-repo/semantics/openAccess https://creativecommons.org/licenses/by-nc-sa/2.5/ar/ |
eu_rights_str_mv |
openAccess |
rights_invalid_str_mv |
https://creativecommons.org/licenses/by-nc-sa/2.5/ar/ |
dc.format.none.fl_str_mv |
application/pdf application/pdf application/pdf |
dc.publisher.none.fl_str_mv |
Wiley Blackwell Publishing, Inc |
publisher.none.fl_str_mv |
Wiley Blackwell Publishing, Inc |
dc.source.none.fl_str_mv |
reponame:CONICET Digital (CONICET) instname:Consejo Nacional de Investigaciones Científicas y Técnicas |
reponame_str |
CONICET Digital (CONICET) |
collection |
CONICET Digital (CONICET) |
instname_str |
Consejo Nacional de Investigaciones Científicas y Técnicas |
repository.name.fl_str_mv |
CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicas |
repository.mail.fl_str_mv |
dasensio@conicet.gov.ar; lcarlino@conicet.gov.ar |
_version_ |
1844614308567187456 |
score |
13.069144 |