First report of Fusarium poae on tomato in Argentina

Autores
Stenglein, Sebastian Alberto; Barreto, D.; Nicholson, P.; Chandler, E.; Brambilla, V.; Piris, E. M.; Saliva, V.; Mitidieri, Mariel Silvina; Salerno, Graciela Lidia
Año de publicación
2009
Idioma
inglés
Tipo de recurso
artículo
Estado
versión publicada
Descripción
During the spring of 2003, blighted flowers were observed on numerous plants (ca. 20%) of a tomato (Solanum lycopersicum formerly Lycopersicon esculentum) crop in two glasshouses (approx. 300–400 m2 each) in San Pedro, Buenos Aires, Argentina. Pedicels of flowers turned chlorotic and later became necrotic. Subsequently, the calyx and the petals turned brown, and the flowers shrivelled and generally abscised. Small pieces of diseased tissue were surface sterilized with 0·5% NaOCl, plated on 2% potato dextrose agar (PDA) at pH 6, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 72–96 h. Microconidia were abundant, globose to piriform, 0–1 septate, 4–10 × 4·5–7 µm, and formed on unbranched and branched monophialides. Cultures produced a fruity aroma similar to amyl acetate. Spores from 14‐day‐old colonies that developed on PDA were removed with 4 mL of sterile water. The pathogenicity of the fungus was tested by spraying five healthy inflorescences of tomato with a 5‐mL suspension (2 × 105 conidia mL−1 of sterile distilled water). Another five healthy inflorescences were sprayed with sterile distilled water. The plants were placed in a growth chamber with a 12‐h photoperiod at 22 ± 2°C and covered with polyethylene bags that were removed after 3 days when plants were moved to a glasshouse. While control flowers were healthy, all inoculated flowers showed symptoms similar to those observed previously. A fungus was consistently isolated from diseased tissue in the inoculated plants and identified as Fusarium poae on the basis of fungal morphology (Nelson et al., 1983) and production of an amplicon of the appropriate size with primers 5′‐CAAGCAAACAGGCTCTTCACC‐3′‐forward and 5′‐TGTTCCACCTCAGTGACAGGTT‐3′‐reverse (Parry & Nicholson, 1996). This is the first report of this fungus on tomato in Argentina. Fusarium poae is one of the main causal agents of fusarium head blight of wheat. The increasing occurrence of this fungus in Argentinean cereals and the finding of F. poae infecting tomato could be of importance due to the close proximity of the two crops in some areas, as this may represent an alternative host. In addition, because of the potential for F. poae to produce trichothecene mycotoxins such as nivalenol, this is of significance as it may pose toxicological risks to consumers if tomato fruit become infected.
Fil: Stenglein, Sebastian Alberto. Universidad Nacional del Centro de la Provincia de Bueno Aires. Facultad de Agronomía. Laboratorio de Biología Funcional y Biotecnología; Argentina
Fil: Barreto, D.. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigación en Ciencias Veterinarias y Agronómicas. Instituto de Microbiología y Zoología Agrícola; Argentina
Fil: Nicholson, P.. Norwich Research Park; Reino Unido
Fil: Chandler, E.. Norwich Research Park; Reino Unido
Fil: Brambilla, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Piris, E. M.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Saliva, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Mitidieri, Mariel Silvina. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Salerno, Graciela Lidia. Consejo Nacional de Investigaciones Cientificas y Tecnicas. Oficina de Coordinacion Administrativa Pque. Centenario. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp | Universidad de Buenos Aires. Facultad de Agronomia. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp. ; Argentina; Argentina
Materia
FUSARIUM POAE
TOMATO
Nivel de accesibilidad
acceso abierto
Condiciones de uso
https://creativecommons.org/licenses/by-nc-sa/2.5/ar/
Repositorio
CONICET Digital (CONICET)
Institución
Consejo Nacional de Investigaciones Científicas y Técnicas
OAI Identificador
oai:ri.conicet.gov.ar:11336/112349

id CONICETDig_af049971708aa5ba60730e5e629a7a79
oai_identifier_str oai:ri.conicet.gov.ar:11336/112349
network_acronym_str CONICETDig
repository_id_str 3498
network_name_str CONICET Digital (CONICET)
spelling First report of Fusarium poae on tomato in ArgentinaStenglein, Sebastian AlbertoBarreto, D.Nicholson, P.Chandler, E.Brambilla, V.Piris, E. M.Saliva, V.Mitidieri, Mariel SilvinaSalerno, Graciela LidiaFUSARIUM POAETOMATOhttps://purl.org/becyt/ford/4.1https://purl.org/becyt/ford/4During the spring of 2003, blighted flowers were observed on numerous plants (ca. 20%) of a tomato (Solanum lycopersicum formerly Lycopersicon esculentum) crop in two glasshouses (approx. 300–400 m2 each) in San Pedro, Buenos Aires, Argentina. Pedicels of flowers turned chlorotic and later became necrotic. Subsequently, the calyx and the petals turned brown, and the flowers shrivelled and generally abscised. Small pieces of diseased tissue were surface sterilized with 0·5% NaOCl, plated on 2% potato dextrose agar (PDA) at pH 6, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 72–96 h. Microconidia were abundant, globose to piriform, 0–1 septate, 4–10 × 4·5–7 µm, and formed on unbranched and branched monophialides. Cultures produced a fruity aroma similar to amyl acetate. Spores from 14‐day‐old colonies that developed on PDA were removed with 4 mL of sterile water. The pathogenicity of the fungus was tested by spraying five healthy inflorescences of tomato with a 5‐mL suspension (2 × 105 conidia mL−1 of sterile distilled water). Another five healthy inflorescences were sprayed with sterile distilled water. The plants were placed in a growth chamber with a 12‐h photoperiod at 22 ± 2°C and covered with polyethylene bags that were removed after 3 days when plants were moved to a glasshouse. While control flowers were healthy, all inoculated flowers showed symptoms similar to those observed previously. A fungus was consistently isolated from diseased tissue in the inoculated plants and identified as Fusarium poae on the basis of fungal morphology (Nelson et al., 1983) and production of an amplicon of the appropriate size with primers 5′‐CAAGCAAACAGGCTCTTCACC‐3′‐forward and 5′‐TGTTCCACCTCAGTGACAGGTT‐3′‐reverse (Parry & Nicholson, 1996). This is the first report of this fungus on tomato in Argentina. Fusarium poae is one of the main causal agents of fusarium head blight of wheat. The increasing occurrence of this fungus in Argentinean cereals and the finding of F. poae infecting tomato could be of importance due to the close proximity of the two crops in some areas, as this may represent an alternative host. In addition, because of the potential for F. poae to produce trichothecene mycotoxins such as nivalenol, this is of significance as it may pose toxicological risks to consumers if tomato fruit become infected.Fil: Stenglein, Sebastian Alberto. Universidad Nacional del Centro de la Provincia de Bueno Aires. Facultad de Agronomía. Laboratorio de Biología Funcional y Biotecnología; ArgentinaFil: Barreto, D.. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigación en Ciencias Veterinarias y Agronómicas. Instituto de Microbiología y Zoología Agrícola; ArgentinaFil: Nicholson, P.. Norwich Research Park; Reino UnidoFil: Chandler, E.. Norwich Research Park; Reino UnidoFil: Brambilla, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; ArgentinaFil: Piris, E. M.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; ArgentinaFil: Saliva, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; ArgentinaFil: Mitidieri, Mariel Silvina. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; ArgentinaFil: Salerno, Graciela Lidia. Consejo Nacional de Investigaciones Cientificas y Tecnicas. Oficina de Coordinacion Administrativa Pque. Centenario. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp | Universidad de Buenos Aires. Facultad de Agronomia. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp. ; Argentina; ArgentinaWiley Blackwell Publishing, Inc2009-12info:eu-repo/semantics/articleinfo:eu-repo/semantics/publishedVersionhttp://purl.org/coar/resource_type/c_6501info:ar-repo/semantics/articuloapplication/pdfapplication/pdfapplication/pdfhttp://hdl.handle.net/11336/112349Stenglein, Sebastian Alberto; Barreto, D.; Nicholson, P.; Chandler, E.; Brambilla, V.; et al.; First report of Fusarium poae on tomato in Argentina; Wiley Blackwell Publishing, Inc; Plant Pathology; 58; 2; 12-2009; 401-4010032-0862CONICET DigitalCONICETenginfo:eu-repo/semantics/altIdentifier/doi/10.1111/j.1365-3059.2008.01973.xinfo:eu-repo/semantics/altIdentifier/url/https://bsppjournals.onlinelibrary.wiley.com/doi/full/10.1111/j.1365-3059.2008.01973.xinfo:eu-repo/semantics/openAccesshttps://creativecommons.org/licenses/by-nc-sa/2.5/ar/reponame:CONICET Digital (CONICET)instname:Consejo Nacional de Investigaciones Científicas y Técnicas2026-05-13T11:13:09Zoai:ri.conicet.gov.ar:11336/112349instacron:CONICETInstitucionalhttp://ri.conicet.gov.ar/Organismo científico-tecnológicoNo correspondehttp://ri.conicet.gov.ar/oai/requestdasensio@conicet.gov.ar; lcarlino@conicet.gov.arArgentinaNo correspondeNo correspondeNo correspondeopendoar:34982026-05-13 11:13:09.785CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicasfalse
dc.title.none.fl_str_mv First report of Fusarium poae on tomato in Argentina
title First report of Fusarium poae on tomato in Argentina
spellingShingle First report of Fusarium poae on tomato in Argentina
Stenglein, Sebastian Alberto
FUSARIUM POAE
TOMATO
title_short First report of Fusarium poae on tomato in Argentina
title_full First report of Fusarium poae on tomato in Argentina
title_fullStr First report of Fusarium poae on tomato in Argentina
title_full_unstemmed First report of Fusarium poae on tomato in Argentina
title_sort First report of Fusarium poae on tomato in Argentina
dc.creator.none.fl_str_mv Stenglein, Sebastian Alberto
Barreto, D.
Nicholson, P.
Chandler, E.
Brambilla, V.
Piris, E. M.
Saliva, V.
Mitidieri, Mariel Silvina
Salerno, Graciela Lidia
author Stenglein, Sebastian Alberto
author_facet Stenglein, Sebastian Alberto
Barreto, D.
Nicholson, P.
Chandler, E.
Brambilla, V.
Piris, E. M.
Saliva, V.
Mitidieri, Mariel Silvina
Salerno, Graciela Lidia
author_role author
author2 Barreto, D.
Nicholson, P.
Chandler, E.
Brambilla, V.
Piris, E. M.
Saliva, V.
Mitidieri, Mariel Silvina
Salerno, Graciela Lidia
author2_role author
author
author
author
author
author
author
author
dc.subject.none.fl_str_mv FUSARIUM POAE
TOMATO
topic FUSARIUM POAE
TOMATO
purl_subject.fl_str_mv https://purl.org/becyt/ford/4.1
https://purl.org/becyt/ford/4
dc.description.none.fl_txt_mv During the spring of 2003, blighted flowers were observed on numerous plants (ca. 20%) of a tomato (Solanum lycopersicum formerly Lycopersicon esculentum) crop in two glasshouses (approx. 300–400 m2 each) in San Pedro, Buenos Aires, Argentina. Pedicels of flowers turned chlorotic and later became necrotic. Subsequently, the calyx and the petals turned brown, and the flowers shrivelled and generally abscised. Small pieces of diseased tissue were surface sterilized with 0·5% NaOCl, plated on 2% potato dextrose agar (PDA) at pH 6, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 72–96 h. Microconidia were abundant, globose to piriform, 0–1 septate, 4–10 × 4·5–7 µm, and formed on unbranched and branched monophialides. Cultures produced a fruity aroma similar to amyl acetate. Spores from 14‐day‐old colonies that developed on PDA were removed with 4 mL of sterile water. The pathogenicity of the fungus was tested by spraying five healthy inflorescences of tomato with a 5‐mL suspension (2 × 105 conidia mL−1 of sterile distilled water). Another five healthy inflorescences were sprayed with sterile distilled water. The plants were placed in a growth chamber with a 12‐h photoperiod at 22 ± 2°C and covered with polyethylene bags that were removed after 3 days when plants were moved to a glasshouse. While control flowers were healthy, all inoculated flowers showed symptoms similar to those observed previously. A fungus was consistently isolated from diseased tissue in the inoculated plants and identified as Fusarium poae on the basis of fungal morphology (Nelson et al., 1983) and production of an amplicon of the appropriate size with primers 5′‐CAAGCAAACAGGCTCTTCACC‐3′‐forward and 5′‐TGTTCCACCTCAGTGACAGGTT‐3′‐reverse (Parry & Nicholson, 1996). This is the first report of this fungus on tomato in Argentina. Fusarium poae is one of the main causal agents of fusarium head blight of wheat. The increasing occurrence of this fungus in Argentinean cereals and the finding of F. poae infecting tomato could be of importance due to the close proximity of the two crops in some areas, as this may represent an alternative host. In addition, because of the potential for F. poae to produce trichothecene mycotoxins such as nivalenol, this is of significance as it may pose toxicological risks to consumers if tomato fruit become infected.
Fil: Stenglein, Sebastian Alberto. Universidad Nacional del Centro de la Provincia de Bueno Aires. Facultad de Agronomía. Laboratorio de Biología Funcional y Biotecnología; Argentina
Fil: Barreto, D.. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigación en Ciencias Veterinarias y Agronómicas. Instituto de Microbiología y Zoología Agrícola; Argentina
Fil: Nicholson, P.. Norwich Research Park; Reino Unido
Fil: Chandler, E.. Norwich Research Park; Reino Unido
Fil: Brambilla, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Piris, E. M.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Saliva, V.. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Mitidieri, Mariel Silvina. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina
Fil: Salerno, Graciela Lidia. Consejo Nacional de Investigaciones Cientificas y Tecnicas. Oficina de Coordinacion Administrativa Pque. Centenario. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp | Universidad de Buenos Aires. Facultad de Agronomia. Instituto de Investigaciones En Biociencias Agricolas y Ambientales. Grupo Vinculado Cent de Est Biodivers y Biotec Mdp- Inba. Fund P/ Invest Biologicas Aplicadas - Mdp. ; Argentina; Argentina
description During the spring of 2003, blighted flowers were observed on numerous plants (ca. 20%) of a tomato (Solanum lycopersicum formerly Lycopersicon esculentum) crop in two glasshouses (approx. 300–400 m2 each) in San Pedro, Buenos Aires, Argentina. Pedicels of flowers turned chlorotic and later became necrotic. Subsequently, the calyx and the petals turned brown, and the flowers shrivelled and generally abscised. Small pieces of diseased tissue were surface sterilized with 0·5% NaOCl, plated on 2% potato dextrose agar (PDA) at pH 6, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 72–96 h. Microconidia were abundant, globose to piriform, 0–1 septate, 4–10 × 4·5–7 µm, and formed on unbranched and branched monophialides. Cultures produced a fruity aroma similar to amyl acetate. Spores from 14‐day‐old colonies that developed on PDA were removed with 4 mL of sterile water. The pathogenicity of the fungus was tested by spraying five healthy inflorescences of tomato with a 5‐mL suspension (2 × 105 conidia mL−1 of sterile distilled water). Another five healthy inflorescences were sprayed with sterile distilled water. The plants were placed in a growth chamber with a 12‐h photoperiod at 22 ± 2°C and covered with polyethylene bags that were removed after 3 days when plants were moved to a glasshouse. While control flowers were healthy, all inoculated flowers showed symptoms similar to those observed previously. A fungus was consistently isolated from diseased tissue in the inoculated plants and identified as Fusarium poae on the basis of fungal morphology (Nelson et al., 1983) and production of an amplicon of the appropriate size with primers 5′‐CAAGCAAACAGGCTCTTCACC‐3′‐forward and 5′‐TGTTCCACCTCAGTGACAGGTT‐3′‐reverse (Parry & Nicholson, 1996). This is the first report of this fungus on tomato in Argentina. Fusarium poae is one of the main causal agents of fusarium head blight of wheat. The increasing occurrence of this fungus in Argentinean cereals and the finding of F. poae infecting tomato could be of importance due to the close proximity of the two crops in some areas, as this may represent an alternative host. In addition, because of the potential for F. poae to produce trichothecene mycotoxins such as nivalenol, this is of significance as it may pose toxicological risks to consumers if tomato fruit become infected.
publishDate 2009
dc.date.none.fl_str_mv 2009-12
dc.type.none.fl_str_mv info:eu-repo/semantics/article
info:eu-repo/semantics/publishedVersion
http://purl.org/coar/resource_type/c_6501
info:ar-repo/semantics/articulo
format article
status_str publishedVersion
dc.identifier.none.fl_str_mv http://hdl.handle.net/11336/112349
Stenglein, Sebastian Alberto; Barreto, D.; Nicholson, P.; Chandler, E.; Brambilla, V.; et al.; First report of Fusarium poae on tomato in Argentina; Wiley Blackwell Publishing, Inc; Plant Pathology; 58; 2; 12-2009; 401-401
0032-0862
CONICET Digital
CONICET
url http://hdl.handle.net/11336/112349
identifier_str_mv Stenglein, Sebastian Alberto; Barreto, D.; Nicholson, P.; Chandler, E.; Brambilla, V.; et al.; First report of Fusarium poae on tomato in Argentina; Wiley Blackwell Publishing, Inc; Plant Pathology; 58; 2; 12-2009; 401-401
0032-0862
CONICET Digital
CONICET
dc.language.none.fl_str_mv eng
language eng
dc.relation.none.fl_str_mv info:eu-repo/semantics/altIdentifier/doi/10.1111/j.1365-3059.2008.01973.x
info:eu-repo/semantics/altIdentifier/url/https://bsppjournals.onlinelibrary.wiley.com/doi/full/10.1111/j.1365-3059.2008.01973.x
dc.rights.none.fl_str_mv info:eu-repo/semantics/openAccess
https://creativecommons.org/licenses/by-nc-sa/2.5/ar/
eu_rights_str_mv openAccess
rights_invalid_str_mv https://creativecommons.org/licenses/by-nc-sa/2.5/ar/
dc.format.none.fl_str_mv application/pdf
application/pdf
application/pdf
dc.publisher.none.fl_str_mv Wiley Blackwell Publishing, Inc
publisher.none.fl_str_mv Wiley Blackwell Publishing, Inc
dc.source.none.fl_str_mv reponame:CONICET Digital (CONICET)
instname:Consejo Nacional de Investigaciones Científicas y Técnicas
reponame_str CONICET Digital (CONICET)
collection CONICET Digital (CONICET)
instname_str Consejo Nacional de Investigaciones Científicas y Técnicas
repository.name.fl_str_mv CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicas
repository.mail.fl_str_mv dasensio@conicet.gov.ar; lcarlino@conicet.gov.ar
_version_ 1865200457213804544
score 13.115601