First report of Strawberry crinkle virus in Argentina
- Autores
- Perotto, Maria Cecilia; Luciani, Cecilia Elizabeth; Celli, Marcos Giovani; Torrico Ramallo, Ada Karina; Conci, Vilma Cecilia
- Año de publicación
- 2014
- Idioma
- inglés
- Tipo de recurso
- artículo
- Estado
- versión publicada
- Descripción
- Strawberry crinkle virus (SCV) is one of the most frequent viruses affecting strawberry worldwide, and responsible for important reductions in yield and fruit quality. Stunted dwarfed plants with distorted leaves were found in Lules (26°55′22″S 65°20′15″W), Tucumán province, Argentina, in 2010, suggesting the virus presence. Total nucleic acids were isolated from leaves of 26 strawberry plants (Fragaria x ananassa cv. Camarosa) showing symptoms using the modified cetyltrimethylammonium bromide method (CTAB). Healthy strawberry plants previously tested by grafting to indicator plants (Fragaria virginiana clone UC-12, F. vesca clone UC-6 and cv. Alpine) were used as negative controls. The extracts were analysed by one-step nested RT-PCR (RT-PCR Kit, Qiagen) with specific primers, which amplify a 573-bp genome fragment corresponding to a conserved region of the rhabdovirus polymerase (L) genes. Two PCR products were cloned into the pCR4-TOPO® vector (TOPO® TA Cloning Kit for Sequencing of Invitrogen Lab) and bi-directionally sequenced. In addition, new primers were designed based on the previously obtained sequences and others retrieved from the GenBank: Cito1/for: TCTATCAACCCTATGCAATATCCG; Cito1/rev: GTAGTATCTTCCAGCCACCTGATG (expected fragment size 744 nt) and Cito2/for: ATGGGACCTATGTACCGGACATC; Cito2/revGGAAATTGTGTCTCTCCCCATTTG (687 nt). The PCR products obtained from each sample were cloned and bi-directionally sequenced. Sequences were assembled using the SeqMan program (Lasergene software, DNAStar ver. 5, 2001), and manual adjustment was done when necessary. The assembly of the three genomic fragments retrieved a consensus sequence (1897 nt), which was deposited in GenBank (Accession No. KJ748457). BLAST analysis showed that the Argentinean isolate has 95% (AY250986.2 - cover 100%) to 89% (JN542482.1 - cover 15%) nucleotide identity with SCV sequences (15). Phylogenetic analysis performed with a 258 nt fragment of 14 SCV sequences downloaded from the GenBank generated a tree in which the Argentinian isolate was grouped in group II according to Klerks et al. (2004). Collectively, the data implicate the SCV as the etiological agent. To our knowledge, this is the first report of Strawberry crinkle virus infecting strawberry in Argentina. Additional studies to complete the characterization are being carried out.
Fil: Perotto, Maria Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Torrico Ramallo, Ada Karina. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina - Materia
-
CYTORHABDOVIRUS
RHABDOVIRUS
L PROTEIN
SCV - Nivel de accesibilidad
- acceso abierto
- Condiciones de uso
- https://creativecommons.org/licenses/by-nc-sa/2.5/ar/
- Repositorio
.jpg)
- Institución
- Consejo Nacional de Investigaciones Científicas y Técnicas
- OAI Identificador
- oai:ri.conicet.gov.ar:11336/180715
Ver los metadatos del registro completo
| id |
CONICETDig_d2f151d6d8444613d60c8c84aed3c973 |
|---|---|
| oai_identifier_str |
oai:ri.conicet.gov.ar:11336/180715 |
| network_acronym_str |
CONICETDig |
| repository_id_str |
3498 |
| network_name_str |
CONICET Digital (CONICET) |
| spelling |
First report of Strawberry crinkle virus in ArgentinaPerotto, Maria CeciliaLuciani, Cecilia ElizabethCelli, Marcos GiovaniTorrico Ramallo, Ada KarinaConci, Vilma CeciliaCYTORHABDOVIRUSRHABDOVIRUSL PROTEINSCVhttps://purl.org/becyt/ford/1.6https://purl.org/becyt/ford/1Strawberry crinkle virus (SCV) is one of the most frequent viruses affecting strawberry worldwide, and responsible for important reductions in yield and fruit quality. Stunted dwarfed plants with distorted leaves were found in Lules (26°55′22″S 65°20′15″W), Tucumán province, Argentina, in 2010, suggesting the virus presence. Total nucleic acids were isolated from leaves of 26 strawberry plants (Fragaria x ananassa cv. Camarosa) showing symptoms using the modified cetyltrimethylammonium bromide method (CTAB). Healthy strawberry plants previously tested by grafting to indicator plants (Fragaria virginiana clone UC-12, F. vesca clone UC-6 and cv. Alpine) were used as negative controls. The extracts were analysed by one-step nested RT-PCR (RT-PCR Kit, Qiagen) with specific primers, which amplify a 573-bp genome fragment corresponding to a conserved region of the rhabdovirus polymerase (L) genes. Two PCR products were cloned into the pCR4-TOPO® vector (TOPO® TA Cloning Kit for Sequencing of Invitrogen Lab) and bi-directionally sequenced. In addition, new primers were designed based on the previously obtained sequences and others retrieved from the GenBank: Cito1/for: TCTATCAACCCTATGCAATATCCG; Cito1/rev: GTAGTATCTTCCAGCCACCTGATG (expected fragment size 744 nt) and Cito2/for: ATGGGACCTATGTACCGGACATC; Cito2/revGGAAATTGTGTCTCTCCCCATTTG (687 nt). The PCR products obtained from each sample were cloned and bi-directionally sequenced. Sequences were assembled using the SeqMan program (Lasergene software, DNAStar ver. 5, 2001), and manual adjustment was done when necessary. The assembly of the three genomic fragments retrieved a consensus sequence (1897 nt), which was deposited in GenBank (Accession No. KJ748457). BLAST analysis showed that the Argentinean isolate has 95% (AY250986.2 - cover 100%) to 89% (JN542482.1 - cover 15%) nucleotide identity with SCV sequences (15). Phylogenetic analysis performed with a 258 nt fragment of 14 SCV sequences downloaded from the GenBank generated a tree in which the Argentinian isolate was grouped in group II according to Klerks et al. (2004). Collectively, the data implicate the SCV as the etiological agent. To our knowledge, this is the first report of Strawberry crinkle virus infecting strawberry in Argentina. Additional studies to complete the characterization are being carried out.Fil: Perotto, Maria Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaFil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaFil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaFil: Torrico Ramallo, Ada Karina. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaFil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaBritish Society for Plant Pathology2014-08info:eu-repo/semantics/articleinfo:eu-repo/semantics/publishedVersionhttp://purl.org/coar/resource_type/c_6501info:ar-repo/semantics/articuloapplication/pdfapplication/pdfapplication/pdfapplication/pdfapplication/pdfapplication/pdfhttp://hdl.handle.net/11336/180715Perotto, Maria Cecilia; Luciani, Cecilia Elizabeth; Celli, Marcos Giovani; Torrico Ramallo, Ada Karina; Conci, Vilma Cecilia; First report of Strawberry crinkle virus in Argentina; British Society for Plant Pathology; New Disease Reports; 30; 5; 8-2014; 5-52044-0588CONICET DigitalCONICETenginfo:eu-repo/semantics/altIdentifier/url/https://bsppjournals.onlinelibrary.wiley.com/doi/10.5197/j.2044-0588.2014.030.005info:eu-repo/semantics/altIdentifier/doi/10.5197/j.2044-0588.2014.030.005info:eu-repo/semantics/openAccesshttps://creativecommons.org/licenses/by-nc-sa/2.5/ar/reponame:CONICET Digital (CONICET)instname:Consejo Nacional de Investigaciones Científicas y Técnicas2026-04-15T10:33:48Zoai:ri.conicet.gov.ar:11336/180715instacron:CONICETInstitucionalhttp://ri.conicet.gov.ar/Organismo científico-tecnológicoNo correspondehttp://ri.conicet.gov.ar/oai/requestdasensio@conicet.gov.ar; lcarlino@conicet.gov.arArgentinaNo correspondeNo correspondeNo correspondeopendoar:34982026-04-15 10:33:48.946CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicasfalse |
| dc.title.none.fl_str_mv |
First report of Strawberry crinkle virus in Argentina |
| title |
First report of Strawberry crinkle virus in Argentina |
| spellingShingle |
First report of Strawberry crinkle virus in Argentina Perotto, Maria Cecilia CYTORHABDOVIRUS RHABDOVIRUS L PROTEIN SCV |
| title_short |
First report of Strawberry crinkle virus in Argentina |
| title_full |
First report of Strawberry crinkle virus in Argentina |
| title_fullStr |
First report of Strawberry crinkle virus in Argentina |
| title_full_unstemmed |
First report of Strawberry crinkle virus in Argentina |
| title_sort |
First report of Strawberry crinkle virus in Argentina |
| dc.creator.none.fl_str_mv |
Perotto, Maria Cecilia Luciani, Cecilia Elizabeth Celli, Marcos Giovani Torrico Ramallo, Ada Karina Conci, Vilma Cecilia |
| author |
Perotto, Maria Cecilia |
| author_facet |
Perotto, Maria Cecilia Luciani, Cecilia Elizabeth Celli, Marcos Giovani Torrico Ramallo, Ada Karina Conci, Vilma Cecilia |
| author_role |
author |
| author2 |
Luciani, Cecilia Elizabeth Celli, Marcos Giovani Torrico Ramallo, Ada Karina Conci, Vilma Cecilia |
| author2_role |
author author author author |
| dc.subject.none.fl_str_mv |
CYTORHABDOVIRUS RHABDOVIRUS L PROTEIN SCV |
| topic |
CYTORHABDOVIRUS RHABDOVIRUS L PROTEIN SCV |
| purl_subject.fl_str_mv |
https://purl.org/becyt/ford/1.6 https://purl.org/becyt/ford/1 |
| dc.description.none.fl_txt_mv |
Strawberry crinkle virus (SCV) is one of the most frequent viruses affecting strawberry worldwide, and responsible for important reductions in yield and fruit quality. Stunted dwarfed plants with distorted leaves were found in Lules (26°55′22″S 65°20′15″W), Tucumán province, Argentina, in 2010, suggesting the virus presence. Total nucleic acids were isolated from leaves of 26 strawberry plants (Fragaria x ananassa cv. Camarosa) showing symptoms using the modified cetyltrimethylammonium bromide method (CTAB). Healthy strawberry plants previously tested by grafting to indicator plants (Fragaria virginiana clone UC-12, F. vesca clone UC-6 and cv. Alpine) were used as negative controls. The extracts were analysed by one-step nested RT-PCR (RT-PCR Kit, Qiagen) with specific primers, which amplify a 573-bp genome fragment corresponding to a conserved region of the rhabdovirus polymerase (L) genes. Two PCR products were cloned into the pCR4-TOPO® vector (TOPO® TA Cloning Kit for Sequencing of Invitrogen Lab) and bi-directionally sequenced. In addition, new primers were designed based on the previously obtained sequences and others retrieved from the GenBank: Cito1/for: TCTATCAACCCTATGCAATATCCG; Cito1/rev: GTAGTATCTTCCAGCCACCTGATG (expected fragment size 744 nt) and Cito2/for: ATGGGACCTATGTACCGGACATC; Cito2/revGGAAATTGTGTCTCTCCCCATTTG (687 nt). The PCR products obtained from each sample were cloned and bi-directionally sequenced. Sequences were assembled using the SeqMan program (Lasergene software, DNAStar ver. 5, 2001), and manual adjustment was done when necessary. The assembly of the three genomic fragments retrieved a consensus sequence (1897 nt), which was deposited in GenBank (Accession No. KJ748457). BLAST analysis showed that the Argentinean isolate has 95% (AY250986.2 - cover 100%) to 89% (JN542482.1 - cover 15%) nucleotide identity with SCV sequences (15). Phylogenetic analysis performed with a 258 nt fragment of 14 SCV sequences downloaded from the GenBank generated a tree in which the Argentinian isolate was grouped in group II according to Klerks et al. (2004). Collectively, the data implicate the SCV as the etiological agent. To our knowledge, this is the first report of Strawberry crinkle virus infecting strawberry in Argentina. Additional studies to complete the characterization are being carried out. Fil: Perotto, Maria Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina Fil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina Fil: Torrico Ramallo, Ada Karina. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina |
| description |
Strawberry crinkle virus (SCV) is one of the most frequent viruses affecting strawberry worldwide, and responsible for important reductions in yield and fruit quality. Stunted dwarfed plants with distorted leaves were found in Lules (26°55′22″S 65°20′15″W), Tucumán province, Argentina, in 2010, suggesting the virus presence. Total nucleic acids were isolated from leaves of 26 strawberry plants (Fragaria x ananassa cv. Camarosa) showing symptoms using the modified cetyltrimethylammonium bromide method (CTAB). Healthy strawberry plants previously tested by grafting to indicator plants (Fragaria virginiana clone UC-12, F. vesca clone UC-6 and cv. Alpine) were used as negative controls. The extracts were analysed by one-step nested RT-PCR (RT-PCR Kit, Qiagen) with specific primers, which amplify a 573-bp genome fragment corresponding to a conserved region of the rhabdovirus polymerase (L) genes. Two PCR products were cloned into the pCR4-TOPO® vector (TOPO® TA Cloning Kit for Sequencing of Invitrogen Lab) and bi-directionally sequenced. In addition, new primers were designed based on the previously obtained sequences and others retrieved from the GenBank: Cito1/for: TCTATCAACCCTATGCAATATCCG; Cito1/rev: GTAGTATCTTCCAGCCACCTGATG (expected fragment size 744 nt) and Cito2/for: ATGGGACCTATGTACCGGACATC; Cito2/revGGAAATTGTGTCTCTCCCCATTTG (687 nt). The PCR products obtained from each sample were cloned and bi-directionally sequenced. Sequences were assembled using the SeqMan program (Lasergene software, DNAStar ver. 5, 2001), and manual adjustment was done when necessary. The assembly of the three genomic fragments retrieved a consensus sequence (1897 nt), which was deposited in GenBank (Accession No. KJ748457). BLAST analysis showed that the Argentinean isolate has 95% (AY250986.2 - cover 100%) to 89% (JN542482.1 - cover 15%) nucleotide identity with SCV sequences (15). Phylogenetic analysis performed with a 258 nt fragment of 14 SCV sequences downloaded from the GenBank generated a tree in which the Argentinian isolate was grouped in group II according to Klerks et al. (2004). Collectively, the data implicate the SCV as the etiological agent. To our knowledge, this is the first report of Strawberry crinkle virus infecting strawberry in Argentina. Additional studies to complete the characterization are being carried out. |
| publishDate |
2014 |
| dc.date.none.fl_str_mv |
2014-08 |
| dc.type.none.fl_str_mv |
info:eu-repo/semantics/article info:eu-repo/semantics/publishedVersion http://purl.org/coar/resource_type/c_6501 info:ar-repo/semantics/articulo |
| format |
article |
| status_str |
publishedVersion |
| dc.identifier.none.fl_str_mv |
http://hdl.handle.net/11336/180715 Perotto, Maria Cecilia; Luciani, Cecilia Elizabeth; Celli, Marcos Giovani; Torrico Ramallo, Ada Karina; Conci, Vilma Cecilia; First report of Strawberry crinkle virus in Argentina; British Society for Plant Pathology; New Disease Reports; 30; 5; 8-2014; 5-5 2044-0588 CONICET Digital CONICET |
| url |
http://hdl.handle.net/11336/180715 |
| identifier_str_mv |
Perotto, Maria Cecilia; Luciani, Cecilia Elizabeth; Celli, Marcos Giovani; Torrico Ramallo, Ada Karina; Conci, Vilma Cecilia; First report of Strawberry crinkle virus in Argentina; British Society for Plant Pathology; New Disease Reports; 30; 5; 8-2014; 5-5 2044-0588 CONICET Digital CONICET |
| dc.language.none.fl_str_mv |
eng |
| language |
eng |
| dc.relation.none.fl_str_mv |
info:eu-repo/semantics/altIdentifier/url/https://bsppjournals.onlinelibrary.wiley.com/doi/10.5197/j.2044-0588.2014.030.005 info:eu-repo/semantics/altIdentifier/doi/10.5197/j.2044-0588.2014.030.005 |
| dc.rights.none.fl_str_mv |
info:eu-repo/semantics/openAccess https://creativecommons.org/licenses/by-nc-sa/2.5/ar/ |
| eu_rights_str_mv |
openAccess |
| rights_invalid_str_mv |
https://creativecommons.org/licenses/by-nc-sa/2.5/ar/ |
| dc.format.none.fl_str_mv |
application/pdf application/pdf application/pdf application/pdf application/pdf application/pdf |
| dc.publisher.none.fl_str_mv |
British Society for Plant Pathology |
| publisher.none.fl_str_mv |
British Society for Plant Pathology |
| dc.source.none.fl_str_mv |
reponame:CONICET Digital (CONICET) instname:Consejo Nacional de Investigaciones Científicas y Técnicas |
| reponame_str |
CONICET Digital (CONICET) |
| collection |
CONICET Digital (CONICET) |
| instname_str |
Consejo Nacional de Investigaciones Científicas y Técnicas |
| repository.name.fl_str_mv |
CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicas |
| repository.mail.fl_str_mv |
dasensio@conicet.gov.ar; lcarlino@conicet.gov.ar |
| _version_ |
1862633356347310080 |
| score |
13.203462 |