First report of Strawberry crinkle virus in Argentina

Autores
Perotto, Maria Cecilia; Luciani, Cecilia Elizabeth; Celli, Marcos Giovani; Torrico Ramallo, Ada Karina; Conci, Vilma Cecilia
Año de publicación
2014
Idioma
inglés
Tipo de recurso
artículo
Estado
versión publicada
Descripción
Strawberry crinkle virus (SCV) is one of the most frequent viruses affecting strawberry worldwide, and responsible for important reductions in yield and fruit quality. Stunted dwarfed plants with distorted leaves were found in Lules (26°55′22″S 65°20′15″W), Tucumán province, Argentina, in 2010, suggesting the virus presence. Total nucleic acids were isolated from leaves of 26 strawberry plants (Fragaria x ananassa cv. Camarosa) showing symptoms using the modified cetyltrimethylammonium bromide method (CTAB). Healthy strawberry plants previously tested by grafting to indicator plants (Fragaria virginiana clone UC-12, F. vesca clone UC-6 and cv. Alpine) were used as negative controls. The extracts were analysed by one-step nested RT-PCR (RT-PCR Kit, Qiagen) with specific primers, which amplify a 573-bp genome fragment corresponding to a conserved region of the rhabdovirus polymerase (L) genes. Two PCR products were cloned into the pCR4-TOPO® vector (TOPO® TA Cloning Kit for Sequencing of Invitrogen Lab) and bi-directionally sequenced. In addition, new primers were designed based on the previously obtained sequences and others retrieved from the GenBank: Cito1/for: TCTATCAACCCTATGCAATATCCG; Cito1/rev: GTAGTATCTTCCAGCCACCTGATG (expected fragment size 744 nt) and Cito2/for: ATGGGACCTATGTACCGGACATC; Cito2/revGGAAATTGTGTCTCTCCCCATTTG (687 nt). The PCR products obtained from each sample were cloned and bi-directionally sequenced. Sequences were assembled using the SeqMan program (Lasergene software, DNAStar ver. 5, 2001), and manual adjustment was done when necessary. The assembly of the three genomic fragments retrieved a consensus sequence (1897 nt), which was deposited in GenBank (Accession No. KJ748457). BLAST analysis showed that the Argentinean isolate has 95% (AY250986.2 - cover 100%) to 89% (JN542482.1 - cover 15%) nucleotide identity with SCV sequences (15). Phylogenetic analysis performed with a 258 nt fragment of 14 SCV sequences downloaded from the GenBank generated a tree in which the Argentinian isolate was grouped in group II according to Klerks et al. (2004). Collectively, the data implicate the SCV as the etiological agent. To our knowledge, this is the first report of Strawberry crinkle virus infecting strawberry in Argentina. Additional studies to complete the characterization are being carried out.
Fil: Perotto, Maria Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Torrico Ramallo, Ada Karina. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Materia
CYTORHABDOVIRUS
RHABDOVIRUS
L PROTEIN
SCV
Nivel de accesibilidad
acceso abierto
Condiciones de uso
https://creativecommons.org/licenses/by-nc-sa/2.5/ar/
Repositorio
CONICET Digital (CONICET)
Institución
Consejo Nacional de Investigaciones Científicas y Técnicas
OAI Identificador
oai:ri.conicet.gov.ar:11336/180715

id CONICETDig_d2f151d6d8444613d60c8c84aed3c973
oai_identifier_str oai:ri.conicet.gov.ar:11336/180715
network_acronym_str CONICETDig
repository_id_str 3498
network_name_str CONICET Digital (CONICET)
spelling First report of Strawberry crinkle virus in ArgentinaPerotto, Maria CeciliaLuciani, Cecilia ElizabethCelli, Marcos GiovaniTorrico Ramallo, Ada KarinaConci, Vilma CeciliaCYTORHABDOVIRUSRHABDOVIRUSL PROTEINSCVhttps://purl.org/becyt/ford/1.6https://purl.org/becyt/ford/1Strawberry crinkle virus (SCV) is one of the most frequent viruses affecting strawberry worldwide, and responsible for important reductions in yield and fruit quality. Stunted dwarfed plants with distorted leaves were found in Lules (26°55′22″S 65°20′15″W), Tucumán province, Argentina, in 2010, suggesting the virus presence. Total nucleic acids were isolated from leaves of 26 strawberry plants (Fragaria x ananassa cv. Camarosa) showing symptoms using the modified cetyltrimethylammonium bromide method (CTAB). Healthy strawberry plants previously tested by grafting to indicator plants (Fragaria virginiana clone UC-12, F. vesca clone UC-6 and cv. Alpine) were used as negative controls. The extracts were analysed by one-step nested RT-PCR (RT-PCR Kit, Qiagen) with specific primers, which amplify a 573-bp genome fragment corresponding to a conserved region of the rhabdovirus polymerase (L) genes. Two PCR products were cloned into the pCR4-TOPO® vector (TOPO® TA Cloning Kit for Sequencing of Invitrogen Lab) and bi-directionally sequenced. In addition, new primers were designed based on the previously obtained sequences and others retrieved from the GenBank: Cito1/for: TCTATCAACCCTATGCAATATCCG; Cito1/rev: GTAGTATCTTCCAGCCACCTGATG (expected fragment size 744 nt) and Cito2/for: ATGGGACCTATGTACCGGACATC; Cito2/revGGAAATTGTGTCTCTCCCCATTTG (687 nt). The PCR products obtained from each sample were cloned and bi-directionally sequenced. Sequences were assembled using the SeqMan program (Lasergene software, DNAStar ver. 5, 2001), and manual adjustment was done when necessary. The assembly of the three genomic fragments retrieved a consensus sequence (1897 nt), which was deposited in GenBank (Accession No. KJ748457). BLAST analysis showed that the Argentinean isolate has 95% (AY250986.2 - cover 100%) to 89% (JN542482.1 - cover 15%) nucleotide identity with SCV sequences (15). Phylogenetic analysis performed with a 258 nt fragment of 14 SCV sequences downloaded from the GenBank generated a tree in which the Argentinian isolate was grouped in group II according to Klerks et al. (2004). Collectively, the data implicate the SCV as the etiological agent. To our knowledge, this is the first report of Strawberry crinkle virus infecting strawberry in Argentina. Additional studies to complete the characterization are being carried out.Fil: Perotto, Maria Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaFil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaFil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaFil: Torrico Ramallo, Ada Karina. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaFil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; ArgentinaBritish Society for Plant Pathology2014-08info:eu-repo/semantics/articleinfo:eu-repo/semantics/publishedVersionhttp://purl.org/coar/resource_type/c_6501info:ar-repo/semantics/articuloapplication/pdfapplication/pdfapplication/pdfapplication/pdfapplication/pdfapplication/pdfhttp://hdl.handle.net/11336/180715Perotto, Maria Cecilia; Luciani, Cecilia Elizabeth; Celli, Marcos Giovani; Torrico Ramallo, Ada Karina; Conci, Vilma Cecilia; First report of Strawberry crinkle virus in Argentina; British Society for Plant Pathology; New Disease Reports; 30; 5; 8-2014; 5-52044-0588CONICET DigitalCONICETenginfo:eu-repo/semantics/altIdentifier/url/https://bsppjournals.onlinelibrary.wiley.com/doi/10.5197/j.2044-0588.2014.030.005info:eu-repo/semantics/altIdentifier/doi/10.5197/j.2044-0588.2014.030.005info:eu-repo/semantics/openAccesshttps://creativecommons.org/licenses/by-nc-sa/2.5/ar/reponame:CONICET Digital (CONICET)instname:Consejo Nacional de Investigaciones Científicas y Técnicas2026-04-15T10:33:48Zoai:ri.conicet.gov.ar:11336/180715instacron:CONICETInstitucionalhttp://ri.conicet.gov.ar/Organismo científico-tecnológicoNo correspondehttp://ri.conicet.gov.ar/oai/requestdasensio@conicet.gov.ar; lcarlino@conicet.gov.arArgentinaNo correspondeNo correspondeNo correspondeopendoar:34982026-04-15 10:33:48.946CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicasfalse
dc.title.none.fl_str_mv First report of Strawberry crinkle virus in Argentina
title First report of Strawberry crinkle virus in Argentina
spellingShingle First report of Strawberry crinkle virus in Argentina
Perotto, Maria Cecilia
CYTORHABDOVIRUS
RHABDOVIRUS
L PROTEIN
SCV
title_short First report of Strawberry crinkle virus in Argentina
title_full First report of Strawberry crinkle virus in Argentina
title_fullStr First report of Strawberry crinkle virus in Argentina
title_full_unstemmed First report of Strawberry crinkle virus in Argentina
title_sort First report of Strawberry crinkle virus in Argentina
dc.creator.none.fl_str_mv Perotto, Maria Cecilia
Luciani, Cecilia Elizabeth
Celli, Marcos Giovani
Torrico Ramallo, Ada Karina
Conci, Vilma Cecilia
author Perotto, Maria Cecilia
author_facet Perotto, Maria Cecilia
Luciani, Cecilia Elizabeth
Celli, Marcos Giovani
Torrico Ramallo, Ada Karina
Conci, Vilma Cecilia
author_role author
author2 Luciani, Cecilia Elizabeth
Celli, Marcos Giovani
Torrico Ramallo, Ada Karina
Conci, Vilma Cecilia
author2_role author
author
author
author
dc.subject.none.fl_str_mv CYTORHABDOVIRUS
RHABDOVIRUS
L PROTEIN
SCV
topic CYTORHABDOVIRUS
RHABDOVIRUS
L PROTEIN
SCV
purl_subject.fl_str_mv https://purl.org/becyt/ford/1.6
https://purl.org/becyt/ford/1
dc.description.none.fl_txt_mv Strawberry crinkle virus (SCV) is one of the most frequent viruses affecting strawberry worldwide, and responsible for important reductions in yield and fruit quality. Stunted dwarfed plants with distorted leaves were found in Lules (26°55′22″S 65°20′15″W), Tucumán province, Argentina, in 2010, suggesting the virus presence. Total nucleic acids were isolated from leaves of 26 strawberry plants (Fragaria x ananassa cv. Camarosa) showing symptoms using the modified cetyltrimethylammonium bromide method (CTAB). Healthy strawberry plants previously tested by grafting to indicator plants (Fragaria virginiana clone UC-12, F. vesca clone UC-6 and cv. Alpine) were used as negative controls. The extracts were analysed by one-step nested RT-PCR (RT-PCR Kit, Qiagen) with specific primers, which amplify a 573-bp genome fragment corresponding to a conserved region of the rhabdovirus polymerase (L) genes. Two PCR products were cloned into the pCR4-TOPO® vector (TOPO® TA Cloning Kit for Sequencing of Invitrogen Lab) and bi-directionally sequenced. In addition, new primers were designed based on the previously obtained sequences and others retrieved from the GenBank: Cito1/for: TCTATCAACCCTATGCAATATCCG; Cito1/rev: GTAGTATCTTCCAGCCACCTGATG (expected fragment size 744 nt) and Cito2/for: ATGGGACCTATGTACCGGACATC; Cito2/revGGAAATTGTGTCTCTCCCCATTTG (687 nt). The PCR products obtained from each sample were cloned and bi-directionally sequenced. Sequences were assembled using the SeqMan program (Lasergene software, DNAStar ver. 5, 2001), and manual adjustment was done when necessary. The assembly of the three genomic fragments retrieved a consensus sequence (1897 nt), which was deposited in GenBank (Accession No. KJ748457). BLAST analysis showed that the Argentinean isolate has 95% (AY250986.2 - cover 100%) to 89% (JN542482.1 - cover 15%) nucleotide identity with SCV sequences (15). Phylogenetic analysis performed with a 258 nt fragment of 14 SCV sequences downloaded from the GenBank generated a tree in which the Argentinian isolate was grouped in group II according to Klerks et al. (2004). Collectively, the data implicate the SCV as the etiological agent. To our knowledge, this is the first report of Strawberry crinkle virus infecting strawberry in Argentina. Additional studies to complete the characterization are being carried out.
Fil: Perotto, Maria Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Torrico Ramallo, Ada Karina. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina
description Strawberry crinkle virus (SCV) is one of the most frequent viruses affecting strawberry worldwide, and responsible for important reductions in yield and fruit quality. Stunted dwarfed plants with distorted leaves were found in Lules (26°55′22″S 65°20′15″W), Tucumán province, Argentina, in 2010, suggesting the virus presence. Total nucleic acids were isolated from leaves of 26 strawberry plants (Fragaria x ananassa cv. Camarosa) showing symptoms using the modified cetyltrimethylammonium bromide method (CTAB). Healthy strawberry plants previously tested by grafting to indicator plants (Fragaria virginiana clone UC-12, F. vesca clone UC-6 and cv. Alpine) were used as negative controls. The extracts were analysed by one-step nested RT-PCR (RT-PCR Kit, Qiagen) with specific primers, which amplify a 573-bp genome fragment corresponding to a conserved region of the rhabdovirus polymerase (L) genes. Two PCR products were cloned into the pCR4-TOPO® vector (TOPO® TA Cloning Kit for Sequencing of Invitrogen Lab) and bi-directionally sequenced. In addition, new primers were designed based on the previously obtained sequences and others retrieved from the GenBank: Cito1/for: TCTATCAACCCTATGCAATATCCG; Cito1/rev: GTAGTATCTTCCAGCCACCTGATG (expected fragment size 744 nt) and Cito2/for: ATGGGACCTATGTACCGGACATC; Cito2/revGGAAATTGTGTCTCTCCCCATTTG (687 nt). The PCR products obtained from each sample were cloned and bi-directionally sequenced. Sequences were assembled using the SeqMan program (Lasergene software, DNAStar ver. 5, 2001), and manual adjustment was done when necessary. The assembly of the three genomic fragments retrieved a consensus sequence (1897 nt), which was deposited in GenBank (Accession No. KJ748457). BLAST analysis showed that the Argentinean isolate has 95% (AY250986.2 - cover 100%) to 89% (JN542482.1 - cover 15%) nucleotide identity with SCV sequences (15). Phylogenetic analysis performed with a 258 nt fragment of 14 SCV sequences downloaded from the GenBank generated a tree in which the Argentinian isolate was grouped in group II according to Klerks et al. (2004). Collectively, the data implicate the SCV as the etiological agent. To our knowledge, this is the first report of Strawberry crinkle virus infecting strawberry in Argentina. Additional studies to complete the characterization are being carried out.
publishDate 2014
dc.date.none.fl_str_mv 2014-08
dc.type.none.fl_str_mv info:eu-repo/semantics/article
info:eu-repo/semantics/publishedVersion
http://purl.org/coar/resource_type/c_6501
info:ar-repo/semantics/articulo
format article
status_str publishedVersion
dc.identifier.none.fl_str_mv http://hdl.handle.net/11336/180715
Perotto, Maria Cecilia; Luciani, Cecilia Elizabeth; Celli, Marcos Giovani; Torrico Ramallo, Ada Karina; Conci, Vilma Cecilia; First report of Strawberry crinkle virus in Argentina; British Society for Plant Pathology; New Disease Reports; 30; 5; 8-2014; 5-5
2044-0588
CONICET Digital
CONICET
url http://hdl.handle.net/11336/180715
identifier_str_mv Perotto, Maria Cecilia; Luciani, Cecilia Elizabeth; Celli, Marcos Giovani; Torrico Ramallo, Ada Karina; Conci, Vilma Cecilia; First report of Strawberry crinkle virus in Argentina; British Society for Plant Pathology; New Disease Reports; 30; 5; 8-2014; 5-5
2044-0588
CONICET Digital
CONICET
dc.language.none.fl_str_mv eng
language eng
dc.relation.none.fl_str_mv info:eu-repo/semantics/altIdentifier/url/https://bsppjournals.onlinelibrary.wiley.com/doi/10.5197/j.2044-0588.2014.030.005
info:eu-repo/semantics/altIdentifier/doi/10.5197/j.2044-0588.2014.030.005
dc.rights.none.fl_str_mv info:eu-repo/semantics/openAccess
https://creativecommons.org/licenses/by-nc-sa/2.5/ar/
eu_rights_str_mv openAccess
rights_invalid_str_mv https://creativecommons.org/licenses/by-nc-sa/2.5/ar/
dc.format.none.fl_str_mv application/pdf
application/pdf
application/pdf
application/pdf
application/pdf
application/pdf
dc.publisher.none.fl_str_mv British Society for Plant Pathology
publisher.none.fl_str_mv British Society for Plant Pathology
dc.source.none.fl_str_mv reponame:CONICET Digital (CONICET)
instname:Consejo Nacional de Investigaciones Científicas y Técnicas
reponame_str CONICET Digital (CONICET)
collection CONICET Digital (CONICET)
instname_str Consejo Nacional de Investigaciones Científicas y Técnicas
repository.name.fl_str_mv CONICET Digital (CONICET) - Consejo Nacional de Investigaciones Científicas y Técnicas
repository.mail.fl_str_mv dasensio@conicet.gov.ar; lcarlino@conicet.gov.ar
_version_ 1862633356347310080
score 13.203462